Table 4 Strains, plasmids, and oligonucleotide primers used in this study

Strains

 P. putida KT2440

Wild-type; capable of dl-lactate utilizing

ATCC

 P. putida KT2440 (ΔlldR)

lldR deletion strain of P. putida KT2440

This study

 P. putida KT2440/pBSPPc_Gm-vgb

P. putida KT2440 harboring pBSPPc_Gm-vgb; Gm^r

This study

 P. putida KT2440 (ΔlldR)/pBSPPc_Gm-vgb

P. putida KT2440 (ΔlldR) harboring pBSPPc_Gm-vgb; Gm^r

This study

 E. coli DH5α

λ⁻ ϕ80lacZ∆M15 ∆ (lacZYA-argF) U169 recA1 endA1 hsdR17 (r ⁻_K , m ⁺_K ) supE44 thi-1 gyrA relA1; used for gene clone

Invitrogen

 E. coli BL21 (pET28b-RgDAAO-VHb)

E. coli BL21 harboring pET28b-RgDAAO-VHb; Km^r

Professor Sheng Yang^a

Plasmids

 pK18mobsacB

Allelic exchange vector, oriColE1 Mob⁺, lacZα, sacB; Km^r

[36]

 pKLR

A fragment from KT2440 genome containing whole length of lldR was inserted in pK18mobsacB; Km^r

This study

 pKSR

pKLR was completely digested by pstI, and then the large fragment was self-ligated; as a result, only partial length of lldR was inserted into pK18mobsacB; Km^r

This study

 pBSPPc_Gm

A constitutive vector with high expression strengths; Gm^r

[44]

 pET28b-RgDAAO-VHb

pET28b containing Rg-daao gene and vgb gene,T7 promoter; Km^r

Professor Sheng Yang^a

 pBSPPc_Gm-vgb

pBSPPc_Gm containing gene vgb; Gm^r

This study

 Primers

Sequences (5′ → 3′) and properties

 lldRk.f

GAATTCATGGTTTTTGATCAGGTACGC (EcoRI)

This study

 lldRk.r

AAGCTTTCAGCGCCCGCTGCGCCGCTCT (HindIII)

This study

 vgb.f

CCCAAGCTTAGGAGACAGTAATGTTAGACCAGCAAACCATTA (HindIII)

This study

 vgb.r

CGCGGATCCTTCAACCGCTTGAGCGTA (BamHI)

This study