Skip to main content

Table 4 Strains, plasmids, and oligonucleotide primers used in this study

From: A novel biocatalyst for efficient production of 2-oxo-carboxylates using glycerol as the cost-effective carbon source

Name Relevant characteristic Reference
Strains
 P. putida KT2440 Wild-type; capable of dl-lactate utilizing ATCC
 P. putida KT2440 (ΔlldR) lldR deletion strain of P. putida KT2440 This study
 P. putida KT2440/pBSPPcGm-vgb P. putida KT2440 harboring pBSPPcGm-vgb; Gmr This study
 P. putida KT2440 (ΔlldR)/pBSPPcGm-vgb P. putida KT2440 (ΔlldR) harboring pBSPPcGm-vgb; Gmr This study
 E. coli DH5α λ ϕ80lacZ∆M15 ∆ (lacZYA-argF) U169 recA1 endA1 hsdR17 (r K , m +K ) supE44 thi-1 gyrA relA1; used for gene clone Invitrogen
 E. coli BL21 (pET28b-RgDAAO-VHb) E. coli BL21 harboring pET28b-RgDAAO-VHb; Kmr Professor Sheng Yanga
Plasmids
 pK18mobsacB Allelic exchange vector, oriColE1 Mob+, lacZα, sacB; Kmr [36]
 pKLR A fragment from KT2440 genome containing whole length of lldR was inserted in pK18mobsacB; Kmr This study
 pKSR pKLR was completely digested by pstI, and then the large fragment was self-ligated; as a result, only partial length of lldR was inserted into pK18mobsacB; Kmr This study
 pBSPPcGm A constitutive vector with high expression strengths; Gmr [44]
 pET28b-RgDAAO-VHb pET28b containing Rg-daao gene and vgb gene,T7 promoter; Kmr Professor Sheng Yanga
 pBSPPcGm-vgb pBSPPcGm containing gene vgb; Gmr This study
 Primers Sequences (5′ → 3′) and properties  
 lldRk.f GAATTCATGGTTTTTGATCAGGTACGC (EcoRI) This study
 lldRk.r AAGCTTTCAGCGCCCGCTGCGCCGCTCT (HindIII) This study
 vgb.f CCCAAGCTTAGGAGACAGTAATGTTAGACCAGCAAACCATTA (HindIII) This study
 vgb.r CGCGGATCCTTCAACCGCTTGAGCGTA (BamHI) This study
  1. ATCC American Type Culture Collection
  2. aForm Institute of Plant Physiology and Ecology, Shanghai Institutes for Biological Sciences, Chinese Academy of Sciences