Skip to main content

Advertisement

Table 7 Oligonucleotide primers used in this study

From: Comparative assessment of native and heterologous 2-oxo acid decarboxylases for application in isobutanol production by Saccharomyces cerevisiae

Name Sequence (5′ → 3′)
Primers for CRISPR-Cas plasmid assembly
 Plasmid backbone amplification GATCATTTATCTTTCACTGCGGAGAAG
 ARO10 gRNA CRISPR KO sequence TGCGCATGTTTCGGCGTTCGAAACTTCTCCGCAGTGAAAGATAAATGATCATTTACAAGTATTCTAAACCGTTTTAGAGCTAGAAATAGCAAGTTA AAATAAGGCTAGTCCGTTATCAAC
 ARO10 repair fragment upper ACAAGTTGACGCGACTTCTGTAAAGTTTATTTACAAGATAACAAAGAAACTCCCTTAAGCAAACTTGTGGGCGCAATTATAAAACACTGCTACCAA TTGTTCGTTTTCTGTTCATTAACA
 ARO10 repair fragment lower TGTTAATGAACAGAAAACGAACAATTGGTAGCAGTGTTTTATAATTGCGCCCACAAGTTTGCTTAAGGGAGTTTCTTTGTTATCTTGTAAATAAACT TTACAGAAGTCGCGTCAACTTGT
Primers for verification of knockouts
 PDC1 upstream fwd AGCTGTCCTCGTTGAACATAG
 PDC1 downstream rev TTGCGTGAGGTTATGAGTAG
 PDC5 upstream fwd CAGAACCACCTACACTACC
 PDC5 downstream rev CTGGGTTCTTAGCATCCTTG
 PDC6 upstream fwd AACTCCCGCAAACAAAGGTG
 PDC6 downstream rev CAACACCTGCGAGATACCGTAG
 Aro10 upstream Fwd TGCTTGTACACCTCATGTAG
 Aro10 downstream Rev GCAGACATTTAGCAGATGTAG
Primers for verification of plasmid assembly and transformation
 GPD1 promoter Fwd GGGATGTGCTGCAAGGCGATTAAGTTGG
 CYC1 terminator Rev GGCAGTGAGCGCAACGCAATTAATGTGAG
Primers for verification of genome integrations
 MTH1ΔT conformation fwd CACCATGTTTGTTTCACCACCACCAGCAACTTCG
 MTH1ΔT conformation rev TCAGGATACTGAATCCGGCTGCCAATCCA
 PDC1-AmdS at ADE2 conformation fwd ATGTTATGCGCCTGCTAGAG
 PDC1-AmdS at ADE2 conformation rev ACATTCCGCCATACTGGAGG
 Cas9-tag-natNT2 at PDC6 conformation fwd AACTCCCGCAAACAAAGGTG
 Cas9-tag-natNT2 at PDC6 conformation rev CAACACCTGCGAGATACCGTAG
Primers for plasmid construction
 KdcA fwd GPDP homology CTACTTTTATAGTTAGTCTTTTTTTTAGTTTTAAAACACCAGAACTTAGTTTCGACGGATATGGATACAGTAGGAGATTACCTGTTAGACCG
 KdcA rev CYC1T homology CGGTTAGAGCGGATGTGGGGGGAGGGCGTGAATGTAAGCGTGACATAACTAATTACATGACTATTTATTTTGCTCAGCAAATAATTTACCC
 KivD fwd GPDP homology CTACTTTTATAGTTAGTCTTTTTTTTAGTTTTAAAACACCAGAACTTAGTTTCGACGGATATGTACACTGTTGGTGACTAC
 KivD rev CYC1T homology CGGTTAGAGCGGATGTGGGGGGAGGGCGTGAATGTAAGCGTGACATAACTAATTACATGATTAAGACTTGTTTTGTTCAGCGAACAACTTACCC
Primers for cassette construction
 MTH1ΔT fwd CACCATGTTTGTTTCACCACCACCAGCAACTTCG
 MTH1ΔT rev TCAGGATACTGAATCCGGCTGCCAATCCA
 PDC1-ADE2 homology fwd TTGCCCCAAGGCCTCACAACTCTGGACATTATACCATTGATGCTTGCGTCACTTCTCAATTTGAAGCTCATTTGAGATCAATATTGGATTTGCCAA TGCCTGCGACTGGGTGAGCATATG
 PDC1-TEF2T homology rev CAGAAAGTAATATCATGCGTCAATCGTATGTGAATGCTGGTCGCTATACTGATCGGTTTTTTTTTTGGAAGACATCTTTTCC
 AmdS cassette fwd CAGTATAGCGACCAGCATTC
 AmdS-ADE2 homology rev GGCATTGGCAAATCCAATATTGATCTCAAATGAGCTTCAAATTGAGAAGTGACGCAAGCATCAATGGTATAATGTCCAGAGTTGTGAGGCCTTG GGGCAAGACATGGAGGCCCAGAATAC
 PDC1-AmdS-ADE2 homology fwd TCTAAGTACATCCTACTATAACAATC
 PDC1-AmdS-ADE2 homology rev CATTTGATGTAATCATAACAAAGCC
 Cas9-PDC6 homology fwd GTGCCTATTGATGATCTGGCGGAATGTCTGCCGTGCCATAGCCATGCCTTCACATATAGTCCGCAAATTAAAGCCTTCGAG
 Cas9-tag homology rev GCAGTCCTCTTTTATATACAGTATAAATAAAAAACCAGTAATATAGCAAAAACATATTGCCAGGGAACAAAAGCTGGAGCTCATAG
 natNT2-tag homology fwd GTGCCTATTGATGATCTGGCGGAATGTCTGCCGTGCCATAGCCATGCCTTCACATATAGTCCGCAAATTAAAGCCTTCGAG
 natNT2-PDC6 homology rev CAAACTGTGTAAATTTATTTATTTGCAACAATAATTCGTTTTTGAGTACACTACTAATGGCATAGGCCACTAGTGGATCTG