Skip to main content

Table 7 Oligonucleotide primers used in this study

From: Comparative assessment of native and heterologous 2-oxo acid decarboxylases for application in isobutanol production by Saccharomyces cerevisiae

Name Sequence (5′ → 3′)
Primers for CRISPR-Cas plasmid assembly
 Plasmid backbone amplification GATCATTTATCTTTCACTGCGGAGAAG
Primers for verification of knockouts
Primers for verification of plasmid assembly and transformation
Primers for verification of genome integrations
 PDC1-AmdS at ADE2 conformation fwd ATGTTATGCGCCTGCTAGAG
 PDC1-AmdS at ADE2 conformation rev ACATTCCGCCATACTGGAGG
 Cas9-tag-natNT2 at PDC6 conformation fwd AACTCCCGCAAACAAAGGTG
 Cas9-tag-natNT2 at PDC6 conformation rev CAACACCTGCGAGATACCGTAG
Primers for plasmid construction
Primers for cassette construction