Skip to main content

Advertisement

Table 2 Primers in this study for gene expression analysis

From: Improving carbohydrate and starch accumulation in Chlorella sp. AE10 by a novel two-stage process with cell dilution

Gene or enzyme EC number Primer pairs (5′–3′) Ref.
18S rRNA F: ATCAACCTGACAAGGCAACC [27]
R: CCTGCGGCTTAATTTGACTC
rbcS 4.1.1.39 F: CTGCGTACACCAGCAACG [33]
R: CCCAGTACCGGTTGTCGTA
NR 1.7.1.1 F: TACTACCACTTCCACGACAACC [33]
R: TACCACCAGCCCTCCTTGT
ME 1.1.1.40 F: CTGCAGGCATGTCCAGTG [33]
R: AGACCCAGGATGCGTTCTC
accC 6.4.1.2 F: CAATCATGATCAAGGCTACCG [33]
R: AGGAACTCGCTCTCGTCCT
AGPase 2.7.7.27 F: AACTCCACCTCGCTCAACC [33]
R: CCAGCACCTCCACAAAGC
SP 2.4.1.1 F: AGCCTGTATCTGCAGGTTGC [33]
R: TTGCAGGTTGGTTGTTTGG
PEPCase 4.1.1.31 F: GTTAATCTTTGCTATCATGCAACC [33]
R: GCTCCTCCAGGATGTGCTC
BAM 3.2.1.2 F: GTACCCGTCCTACCCAGAGG [27]
R: TGTCGTAGCACTGGAACTGG
ISA 3.2.1.10 F: CCACCGCCTCTGTCAACT [27]
R: CGTTGGCCTCATTGTGCT
PGM 5.4.2.2 F: GACTCCAACATTGCGAAGAT This study
R: GGAAGAGGTCGGTCAGGT
SS 2.4.1.21 F: GCCTGGTCAACCTGTGGAT This study
R: GAACACCTGCCGCATCAC
AGB 2.4.1.18 F: TGATGTGCTTCCTCACCCT This study
R: TCCAAAGTGTCCTGGTCCT