Skip to main content

Advertisement

Table 1 Putative regulatory motifs enriched in the SCBV21 promoter

From: A novel Sugarcane bacilliform virus promoter confers gene expression preferentially in the vascular bundle and storage parenchyma of the sugarcane culm

Motif name and sequencea Occurrence and position of motifb Function
Tissue-specific motifs   Expression in phloem, shoot, root, meristem
 ASL-box: CTTTA 2 (844; 1631)
Plant transcription factor motifs   Biological process phloem or xylem biogenesis
 Motif 1: AAAAGGGAGCAAAAGGATTAA 1 (298–318)
 Motif 2: TTGAACGATGATTAT 1 (1288–1302)
 Motif 3: ATAAAGAAGCTAAAGCTGAAT 1 (1252–1272)
 Motif 4: TGAAGAAGGATAAAGAAGCTA 1 (1243–1263)
Enhancer element motif   Enhancement of gene expression
 CAAT-box: CAAT 7 (909; 1075; 1201; 1475; 1511; 1540; 1558)
Meristem-regulated motif   Meristem-regulated gene expression
 CAT-box: CAT 1 (1087)
  1. aMotifs were identified by PlantCARE motif sampler (http://bioinformatics.psb.ugent.be/webtools/plantcare) and PLACE for plant cis-acting regulatory DNA elements (https://sogo.dna.affrc.go.jp/cgi-bin/). Plant transcription factor motifs were identified by PlantTFDB version 4.0 (http://planttfdb.cbi.pku.edu.cn)
  2. bThe motif position is given by the number corresponding to the SCBV21 promoter nucleotide sequence provided in Additional file 2: Figure S1