A novel Sugarcane bacilliform virus promoter confers gene expression preferentially in the vascular bundle and storage parenchyma of the sugarcane culm

Table 1 Putative regulatory motifs enriched in the SCBV21 promoter

Motif name and sequence^a	Occurrence and position of motif^b	Function
Tissue-specific motifs		Expression in phloem, shoot, root, meristem
ASL-box: CTTTA	2 (844; 1631)	Expression in phloem, shoot, root, meristem
Plant transcription factor motifs		Biological process phloem or xylem biogenesis
Motif 1: AAAAGGGAGCAAAAGGATTAA	1 (298–318)
Motif 2: TTGAACGATGATTAT	1 (1288–1302)
Motif 3: ATAAAGAAGCTAAAGCTGAAT	1 (1252–1272)
Motif 4: TGAAGAAGGATAAAGAAGCTA	1 (1243–1263)
Enhancer element motif		Enhancement of gene expression
CAAT-box: CAAT	7 (909; 1075; 1201; 1475; 1511; 1540; 1558)	Enhancement of gene expression
Meristem-regulated motif		Meristem-regulated gene expression
CAT-box: CAT	1 (1087)	Meristem-regulated gene expression

^aMotifs were identified by PlantCARE motif sampler (http://bioinformatics.psb.ugent.be/webtools/plantcare) and PLACE for plant cis-acting regulatory DNA elements (https://sogo.dna.affrc.go.jp/cgi-bin/). Plant transcription factor motifs were identified by PlantTFDB version 4.0 (http://planttfdb.cbi.pku.edu.cn)
^bThe motif position is given by the number corresponding to the SCBV21 promoter nucleotide sequence provided in Additional file 2: Figure S1

ISSN: 2731-3654