Skip to main content

Table 2 Primers and probes used in this study

From: A long noncoding RNA promotes cellulase expression in Trichoderma reesei

Name Sequence (5′–3′) Employment(s)
act1f TGAGAGCGGTGGTATCCACG qPCR
act1r GGTACCACCAGACATGACAATGTTG qPCR
amdS inv for CAAAGGAAGAATCCCTTCAGGGTTGCGTTTCCAG Inverse PCR
amdS inv rev CGCAGTTGCGTGGGATGACATTCATACTCAAGAC Inverse PCR
hax1 for_down-Intron CCAGCTCCAACAGAACCAGG Sequencing
hax for_inter-Intron GCAATGTCGCCAGGCACCG qPCR
hax1 for_qPCR_QM9414 GTTCAAGCCCGTTCAAGCCC qPCR
hax1 for_QM6a_BcuI CAGCAGTACTAGTCCCACCGGCAGGTGGCTAAACGG Qualitative PCR, cloning OEhax1
hax1 for_QM9414_BcuI CAGCAGACTAGTGGTCAGGCCCGTTCAAGCCCGTTC Qualitative PCR, cloning OEhax1
hax1 for_Rut-C30_BcuI CAAGACTAGTGAAGTTCCACACGGATACAGAGACACAACATG Qualitative PCR, cloning OEhax1
hax1 for_3 TGCCTTGCATCGTACCGCTG qPCR
hax1 for_3′RACE_3 AGGTGCTAAAACTGAATGGATGG RACE
hax1 rev TCCGCAAAACGAACCGAACC qPCR
hax1 rev_down-Intron GAGCGGCAGGAGGATGGATTC qPCR
hax1 rev_inter-Intron GAGGTGCGCCGCGAATCTG Sequencing
hax1 rev kurz TGAGTCGAGGGGCTACTGCAAGTAC qPCR
hax1 rev_up-Intron GCCATCCATTCAGTTTTAGCACC qPCR, RACE
hax1 rev_1.Intron CACGCATTTCATCTGGCCATTG qPCR
hax1 rev_3′QM6a CACGCATTTCATCTGGCCATTGAGTATCTACG Qualitative PCR, cloning OEhax1
hax1 rev_3-39_XbaI CAGCAGTCTAGAGACTTCTTGGTATTGTCGTCACCTTATG Sequencing
hax1 rev_5′RACE_2 CTACGATACACCGACTTCTTGG RACE
hax1 rev_ 5′RACE_4 CGTCCCCACAATAGCCATGAGCCG RACE
Isopropylmalate synthase forward TCCCGAATGCTTCTCCGACA qPCR
Isopropylmalatesynthase_rev GCTCTCTCTGTCTCCGATGTTGG qPCR
Locus for CGCGCTCTCTTTTCCTCCTT Dhax1 candidate screening
Locus rev GCAGAACCCAGGACACAAAGAGC Dhax1 candidate screening
Locus 3′for Acc65I GGTACCTGAGGTGTATGATTCCGTGATG Cloning Dhax1
Locus 3′rev XbaI TCTAGATCCTGTTCGGCCCAGCCC Cloning Dhax1
Locus 5′for SalI GGGAATAACCAATGCCTCTGAAGCTT Cloning Dhax1
Locus 5′rev HindIII GGGAATAACCAATGCCTCTGAAGCTT Cloning Dhax1
Pbgl1 for_Kpn2I CAAGTCCGGAGCAAGCGATAACCATAGGTA Cloning OEhax1
Pbgl1 rev-NheI CAACAAGCTAGCCTCAACAAAGCAGAGTCTTG Cloning OEhax1
5pyr4_fwd(BglII) GCGGAAGATCTCGAGATAGTATCTC OEhax1 candidate screening
sar1fw TGGATCGTCAACTGGTTCTACGA qPCR
sar1rev GCATGTGTAGCAACGTGGTCTTT qPCR
sonde hax_5-biotin [biotin]CGTCAGCCACCAGCCACCGTTTAGCCACCT HAX1 enrichment
Unknown protein forward CGCCGTATTGGGGTTCATTG qPCR
Unknown protein reverse GGCTAAACGTTGTCTCGGAG qPCR
up-hax1 for_1 ACATGCAGGAGATTGGGCGTC qPCR
up-hax1 for_2 CGCGGCTTAATCAGAGGTGGG qPCR