Skip to main content

Advertisement

Table 3 Sequences of oligonucleotide primers used in this study

From: Developing cellulolytic Yarrowia lipolytica as a platform for the production of valuable products in consolidated bioprocessing of cellulose

Primer names Sequence (5′-3′), 15-bp homologous sequence for infusion is underlined
F1 GAGTTTGGCGCCCGTTTTTTCG
R1 TGCTGTAGATATGTCTTGTGTGTAAGGGGG
F2 GACATATCTACAGCAGGATCCCACAATGATCTTCTCTCT
R2 ACGGGCGCCAAACTCATCGATTCTAGGGATAACAGGGTAA
F3 GACATATCTACAGCAGGATCCCACAATGAAGCTTTCC
R3 ACGGGCGCCAAACTCATCGATTCTAGGGATAACAGGGTAATTA
F4 TTATCCCTAGAATCGGAGTTTGGCGCCCGTTTTTTCG
R4 CTTGCGGCGGCATCGGAATTCGATTTGTCTTAGAGGAACGCATATACA
F5 CAGCAGGATCCCACAATGACTATCGACTCACAATACTACAAGTCG
R5 TGAGAACCCCCTAGGTTACTCAATCATTCGGAACTCTGGG
F6 CCGAAGGATCCCACAATGGTGAAAAACGTGGACCAAGTGG
R6 TGAGAACCCCCTAGGCTAAGCAGCCATGCCAGACATACCG
JMP1F CCTAGGGGGTTCTCACCATCATCAC
JMP1R TGTGGGATCCTGCTGTAGATATGTCTTG
JMP2F CCTAGGGGGTTCTCACCATCATCACC
JMP2R TGTGGGATCCTTCGGGTGTGAGTTG