Skip to main content

Advertisement

Table 1 Primers used for cloning of CmAA10

From: A colorimetric assay to rapidly determine the activities of lytic polysaccharide monooxygenases

Primer Sequence (5′–3′)
pelB leader forward CATATGAAATACCTGCTGCC
pelB-CmAA10 reverse CAAAGCCATGGGCCATCGCC
pelB-CmAA10 forward GGCGATGGCCCATGGCTTTG
CmAA10 reverse CTCGAGACGCGGTGCATTAC