Skip to main content

Advertisement

Springer Nature is making SARS-CoV-2 and COVID-19 research free. View research | View latest news | Sign up for updates

Table 4 Strains, plasmids and primers used in this study

From: Xylose fermentation efficiency of industrial Saccharomyces cerevisiae yeast with separate or combined xylose reductase/xylitol dehydrogenase and xylose isomerase pathways

  Relevant features Source
S. cerevisiae strains
 PE-2∆GRE3 S. cerevisiae PE-2 (isolated from Brazilian first generation bioethanol plants [44, 46], gre3::natMX4/gre3::kanMX4 Romaní et al. [13]
 PE-XR/XDH PE-2∆GRE3, pMEC1049 Romaní et al. [13]
 PE-XR/XDH + XI PE-2∆GRE3, pMEC1049 + XI This work
 PE-XI PE-2∆GRE3, pMEC_XI This work
 CA11 S. cerevisiae strain isolated from Brazilian “cachaça” fermentation processes Pereira et al. and Schwan et al. [43, 44]
 CA11-XR/XDH CA11, pMEC1049 Costa et al. [14]
 CA11-XR/XDH + XI CA11, pMEC1049 + XI This work
 CA11-XI CA11, pMEC_XI This work
Plasmids
 pMEC1049 pYPK4-TEF1tp-XR(N272D)-TDH3tp-XDH-PGI1tp-XKS1-FBA1tp-TAL1- PDC1tp, HphMX4 Romaní et al. [13]
 pBED-CpXI-NATMX Plasmid containing the xylA gene from Clostridium phytofermentans with HXT7 promoter and CYC terminator Brat et al. [20]
 pMEC1049 + XI pMEC1049 containing the xylA gene from C. phytofermentans with HXT7 promoter and CYC terminator This work
 pYPKa_Z_PGI1tp   Pereira et al. [47]
 pMEC_XI pMEC1049 + XI after removal of XR and XDH coding sequences This work
Primers Sequence (5′– > 3′)  
XI_FW ACGATTTAGGTGACACTATAGAACGCGGCCGCCAGGAGCTCGTAGGAACAA  
XI_RV GGGGATCCGTCGACCTGCAGCGTACGAAGCTTCAGCCGATCTCCAGCCGAC  
577 GTTCTGATCCTCGAGCATCTTAAGAATTC  
567 GTCGGCTGCAGGTCACTAGTGAG