Skip to main content

Table 1 RBS sequence and predicted translation initiation rate of odhA

From: Engineering Corynebacterium glutamicum triggers glutamic acid accumulation in biotin-rich corn stover hydrolysate

Name Sequence (5′–3′)a Predicted translation initiation rate (a.u.)
Original CAAGGAAAAGAGGCGAGTACCTGCC 50.38
RBS20 GCTAAATATCATACCGATAAAGTCATA 20.72
RBS10 GGTCCCTCAAGTTAACCACGCGGC 10.33
RBS0.1 CTCACCCACGAGTTCAATAACTAGG 0.11
  1. aThe strength prediction of original RBS sequence of odhA and the design of RBS sequence with different strength are carried out by RBS Calculator (https://www.denovodna.com/software/doLogin)