Skip to main content

Table 2 Primers used in this study

From: Biological conversion of methane to putrescine using genome-scale model-guided metabolic engineering of a methanotrophic bacterium Methylomicrobium alcaliphilum 20Z

Primers Primer sequence 5′ → 3′
pAWP89-ptac-For TAGTTGTCGGGAAGATGCGT
pAWP89-ptac-Rev AGCTGTTTCCTGTGTGAATA
FWD_speCEc cacacaggaaacagctATGAAATCAATGAATATTGCC
REV_speCEc gtgaatacctTTACTTCAACACATAACCGT
FWD_potE tgttgaagtaaAGGTATTCACACAGGAAACAGCTATGAGTCAGGCTAAATCGA
REV_potE gcatcttcccgacaactaTTAACCGTGTTTATTTTTCAGT
FWD_speCOb ttcacacaggaaacagctATGACCGATCGTATCCGCGAA
REV_speCOb gcatcttcccgacaacta TCAGATCACGAAGGATTCGAG
FWD_speE F1 tggtctgacagttaccaGCCGGAAATGATGAAGTCCA
REV_speE F1 gggatttctTGCGCATTAGTTATCGAGGAG
FWD_speE F2 taatgcgcaAGAAATCCCTGCAGTGTTGA
REV_speE F2 ccgacaacctgcacatTTCGTTTAAGGTCTGTGCGA
FWD_433speEc TGTTGCCTTGTGCCGACAT
REV_433speEc ACCAACACCGGTAACGATAG
FWD_argD aggtattcacacaggaaacagctATGACCGGCCACATTATGC
REV_argD tgaatacctCTAGGGTTCATTGGCTTGATG
FWD_argJ tgaaccctagAGGTATTCACACAGGAAACAGCTATGGCGGTGGGGCAGGT
REV_argJ gcatcttcccgacaactaCTAAGTCCGATACTCCGCAT
FWD_pTac-argDJ atgtgcttcTCACATGTTCTTTCCTGCGT
REV_pTac-argDJ atgctatacgaagttatgcTCGAACTTTTGCTGAGTGGA
FWD_351argDJ_F1 acctgacgtctagatctgCGGCTACAACGTTCTGAAAG
REV_351argDJ_F1 gaagcacatGAAGCACATTCGAGCCTGAA
FWD_351argDJ_F2 gtgttaaccggtgagctTGTTTCAGGATGTCGCTTGG
REV_351argDJ_F2 ggatcctctagtgagctATGTTTAAAAGCTTCGCGGC
FWD_351c CATGACTTCATGAACGATGA
REV_351c TCCGACCAATAATCGTAATG
  1. Homologous sequences for Gibson assembly are in lowercase; ribosome binding sites are in bold