Skip to main content

Table 2 List of genes and primers for RT-qPCR used in this study

From: Oxidative stress tolerance contributes to heterologous protein production in Pichia pastoris

Name Primer sequence (5ʹ-3ʹ)
ACT1 F: TATTGAAGTTGAAGCCCTCTGAGC
R: CCTTCCGTGTGCAAATGAAACAC
CAT F: TTCGACAACGCTAATCACGCTAAC
R: TCACCTCAAACTCACCGAAAGCT
SOD1 F: TCGAACAATCCTCCGAAAGCAGC
R: CCGTGGGTCTTACCAAATGGGT
AHP1 F: CTGGAGTCTTAGCTTGTGCTATTCC
R: CGTCGATTTTCTCAATGAAAACAGG
GLR1 F: GGTGCAAAGACCCTTTTGATTGAAG
R: GGTCCAGTTAAAGGAAAAATCGCC
TRR1 F: GGGTATGTTGGCTAACGGTATCG
R: GGTCTCGGTAATGATCTCAGTGCC
GSH2 F: GCGATGTACCCCACCAATTTTGAG
R: GCCCAGCCATTCCTGATTTTTGA
ZWF1 F: AGGGCGACGAGGACAAAGTTC
R: GGGCAAAGCTAAGTAGAACAACCTG
GND2 F: GGTTTCACCGTCGTCGCTTACA
R: CGGGATTACCAGCCTTGACCAATA
Mxr1 F: CCACAGTTGCAATACCAACAATCTC
R: CGGAGAAGGAAGCTCTTCTTAGT
Prm1 F: ACAGGGACAATCTCTGAGTCTGA
R: GTTGGAGCACTGTTGGGGTATAT
Mit1 F: GGTTCAAACTCTGGCAGTTCAGAT
R: CCATTGGACATTCCATTGAAACCG
  1. All ORF sequences can be found from http://PICHIAGENOME.org database
  2. Forward (F) and reverse (R) primer sequences