Skip to main content

Table 5 Target sequences used in yeast transformation

From: Screening novel genes by a comprehensive strategy to construct multiple stress-tolerant industrial Saccharomyces cerevisiae with prominent bioethanol production

Target Sequence
gRNA insert  
 tgR-F TGCGCATGTTTCGGCGTTCGAAACTTCTCCGCAGTGAAAGA
TAAATGATC
 tgR-R GTTGATAACGGACTAGCCTTATTTTAACTTGCTATTTCTAGC
TCTAAAAC
 ENA5 CS GATAACGTATGTACTCACTGAGG
 CRZ1 CS GCAGAATGTCTACTACGTCGAGG
 ASP3 CS GCTACGGCATGGATCAGATTAGG
 TOS8 CS AGAAATTACATAATAACTGTAGG
 YOL162W CS AAGGTACAATGTTTAATAAATGG
 YOR012W CS TTGAAACTTTTTCAGTGATTGGG
Repair fragment
 TEF1 F CACACACCATAGCTTCAAAATG
  R TTTGTAATTAAAACT
 ENA5 RF F CCTTCATCCTTTACATCGAGAATACGTTAACCAAATCAACCACACACCATAGCTTCAAAATG
  RF R ATTCTTCATTATTGTTTTCTTTGACAGTTCCCTCGCTCATTTTGTAATTAAAACT
  VP F TTGTGAGGCTGATGTTTTCTTC
  VP R GCTTCTTCTGTAGTCAATGTGTGAT
 CRZ1 RF F GGGCTGAAAAGTACATCCGCGCATTTAACAATTGCTAAGCCACACACCATAGCTTCAAAATG
  RF R TAGTCATGTAGGAAGCCATATTTCCGTTGCTGAATGACATTTTGTAATTAAAACT
  VP F GCTTTGACTGCACTTTAGCTTAG
  VP R TTTCCGTTGCTGAATGACAT
 ASP3 RF F AGAGCAAATGTTGGCTCGCTATTCTTTTGTAAGCAATCTGGTACTCACCAACCTCCAACTAGCCTGATCAGTGACTTTTCATCACACTGTGTTTTTATATAGTTCTTAGTAGTAAATATA
  RF R TATATTTACTACTAAGAACTATATAAAAACACAGTGTGATGAAAAGTCACTGATCAGGCTAGTTGGAGGTTGGTGAGTACCAGATTGCTTACAAAAGAATAGCGAGCCAACATTTGCTCT
  VP F TATCAGACCCTTCAGCACGT
  VP R TGACACTGCTCAAGGGATAA
 TOS8 RF F TTTTTCAGTATAGGAAGTAATCACTGTAGAAATAAGTCAACAATAATTGCATAGAAAAAATTTTACTTTTTTCGGAATTACCTAAAATGGGTTTACGGCATAGAAGATAGATAGATTAAG
  RF R CTTAATCTATCTATCTTCTATGCCGTAAACCCATTTTAGGTAATTCCGAAAAAAGTAAAATTTTTTCTATGCAATTATTGTTGACTTATTTCTACAGTGATTACTTCCTATACTGAAAAA
  VP F GTTCCCTTGTTTTGAAGCAC
  VP R CGAAGATTCTCACCAAAGTT
 YOL162W RF F ATGTCACTTAAAATGTTATGGCAGGGGATAACAGATTACTATATATAGCCTATCTACTTGACTATGTAGAAATATGGATACAATCTCCATGTTATGTATTTTTTAAGTTTGTGAATCATT
  RF R AATGATTCACAAACTTAAAAAATACATAACATGGAGATTGTATCCATATTTCTACATAGTCAAGTAGATAGGCTATATATAGTAATCTGTTATCCCCTGCCATAACATTTTAAGTGACAT
  VP F CTAAGCAATCACCTAAACAT
  VP R GATGTCGTACTTCTACAGCT
YOR012W RF F GAAAAAGGCAGTGACAAAAATACTAATCAGAACGTTGAAAACAAATCAATAGTTTTGATACCATCCCGAAATTAGAGGTTCAGTCAGAAAAATACTCGAAAAATATAAAACCAAAGCAGA
  RF R TCTGCTTTGGTTTTATATTTTTCGAGTATTTTTCTGACTGAACCTCTAATTTCGGGATGGTATCAAAACTATTGATTTGTTTTCAACGTTCTGATTAGTATTTTTGTCACTGCCTTTTTC
  VP F TGCCTCATAACGTCTTGGGG
  VP R GTAGGCCGTGAATCCCTTCC
  1. tgR-F: upstream homologous of gRNA; tgR-R: downstream homologous of gRNA; CS: complementary sequence; RF: repair fragment; Vp: verification primer; F: forward primer; R: reverse primer, “double underline” represent the PAM (NGG) site, “underline” represent homologous arm