Skip to main content

Table 4 PCR primers used in this study

From: Efficient yeast cell-surface display of exo- and endo-cellulase using the SED1 anchoring region and its original promoter

Primers Sequence
BGL1-F atgcaactgttcaatttgcc
BGL1-PG-R gggcccgggcccgggttgcaccttcgggagc
SAG1a-PG-F cccgggcccgggcccagcgccaaaagctctt
SAG1a-R taaaatctgcggtgagacgg
SED1a-PG-F cccgggcccgggcccaaattatcaactgtcctattatctgc
SED1a-BsrGI-R gccatctgtacattataagaataacatagcaacaccag
SED1a-XhoI-F gccatcctcgagtaaattatcaactgtcctattatctgc
EGII-NcoI-F gccatcccatgggtcagcagactgtctggggc
EGII-XhoI-R gccatcctcgagccctttcttgcgagacacgag
SED1p-CBA-F cctcttcgctattacgccagattggatatagaaaattaacgtaaggc
SED1p-CBA-R ggcaaattgaacagttgcatcttaatagagcgaacgtatttt
VS-CBA-F aatacgttcgctctattaagatgcaactgttcaatttgcc
VS-CBA-R gttaattttctatatccaatctggcgtaatagcgaagagg