Skip to main content

Table 3 Primers used for PCR amplification of genes

From: Metabolic engineering of microbes for branched-chain biodiesel production with low-temperature property

Primer name Primer sequence (5′-3′)
ilvC-XbaI GTATCTAGAAAGAGGAGATATAATGGCTAACTACTTCAATACACTGAATCTG
ilvC-SpeI-BamHI ACTGGATCCACTAGTTTAACCCGCAACAGCAATACGTT
ilvD-XbaI GTATCTAGAAAGAGGAGATATAATGCCTAAGTACCGTTCCGCCA
ilvD-SpeI-BamHI ACTGGATCCACTAGTTTAACCCCCCAGTTTCGATTTATCG
BCKD-SacI AGATGAGCTCATGGCAACTGAGTATGACGTAGTCATTC
BCKD-SpeI AGTACTAGTTTAGTAAACAGATGTCTTCTCGTCAATCG
fabHB-BamHI ACTGGATCCAAGAAGGAGATATAATGTCAAAAGCAAAAATTACAGCTATCGG
fabHB-XhoI TGTCTCGAGTTACATCCCCCATTTAATAAGCAATCCTG
WS/DGAT-SfuI AGGTTTCGAAATGAGACCATTACACCCTATTGATTTC
WS/DGAT-EcoRI GACGAATTCTTAGTTGGCAGTCTTAATGTCTTCTTG
HIS4-BamHI AATGGATCCCTCGCAGCTGATGAATATCTTGTG
HIS4-BglII CAAGGATCCACCGATACCAGGATCTTGCCAT
ARO10-SfuI GCGTTCGAAATGGCACCTGTTACAATTGAAAAGTTC
ARO10-EcoRI CCGTCTAGACTATTTTTTATTTCTTTTAAGTGCCGCTG
ADH2-SfuI CCGTTCGAAATGTCTATTCCAGAAACTCAAAAAGCC
ADH2-EcoRI GCGGAATTCTTATTTAGAAGTGTCAACAACGTATCTACCAG