Skip to main content

Advertisement

Table 1 Sequences of specific primers used for real-time PCR

From: Transcriptome and key genes expression related to carbon fixation pathways in Chlorella PY-ZU1 cells and their growth under high concentrations of CO2

Gene EC no. Sense Antisense
Rubisco 4.1.1.39 CTCCACCCGCTCCGTCTAAG GACAAACTCGTGCGACATTCTT
Nitrate reductase 1.7.1.1 GGGATGGGCGACCTTGAT GCCTCCCGAACCTTGAGAA
CA 4.2.1.1 TGTGAGCGGACAGCAACCA GGGACGAAGAGGAGAAGAGGG