Transcriptome and key genes expression related to carbon fixation pathways in Chlorella PY-ZU1 cells and their growth under high concentrations of CO₂

Strains and media

This strain used in the present study was Chlorella PY-ZU1, a highly CO₂-tolerant and fast-growing microalgal species that obtained from Chlorella pyrenoidosa after γ irradiation and high CO₂ domestication [6]. The cells were maintained and cultivated in Brostol’s solution (also known as soil extract, SE) [1, 6].

Analysis of differentially expressed Chlorella PY-ZU1 genes under continuous aeration with 15% CO₂ and air

Chlorella PY-ZU1 strains were cultivated in SE medium under 15% CO₂ or air. Cells in the logarithmic phase (after cultivated 36 h) were collected by centrifugation for DNA extraction. The gene for full-length 18s rDNA was amplified to obtain the algal genome according to the protocol performed in Cheng’s study [16]. The following primers were utilized to amplify 18s rDNA: 18s-F, AACCTGGTTGATCCTGCCAGT and 18s-R, TGATCCTTCTGCAGGTTCACCT. The gene was inserted into the cloning vector, pMD19-T. Positive results were selected for sequencing. Total RNA was extracted by TRIzol reagent (Invitrogen) for cDNA library construction and Illumina sequencing. mRNA was separated by magnetic sand method, cleaved to synthesize double-stranded cDNA, and filled to plane. Poly (A) was added at the 3ʹ terminal end, and index connection was linked using TruSeq™ RNA Sample Preparation Kit. The target strip was enriched using polymerase chain reaction (PCR; 15 cycles) and recycled by 2% agarose gel. Quantitative determination was performed by TBS380 (Picogreen). Bridge amplification was conducted to generate cBot clusters. The 2*100 bp sequencing test was performed by HiSeq 2000 sequencing platform. Sequence assembly and annotation were similar to those performed in Cheng’s study [16].

Gene expression statistics and differential expression analysis

Total RNA extracted from algae grown in normal medium (under Air) and high-CO₂ medium [15% (v/v) CO₂] was used to prepare gene expression libraries using the Illumina Gene Expression Sample Prep Kit and then subjected to Illumina sequencing. The RNA-Seq reads were mapped to our transcriptome reference database, and transcript abundances were quantified by RSEM (http://deweylab.biostat.wisc.edu/rsem/). Genes with differential expression between these two samples were identified using the numbers of mapped reads as EdgeR inputs (http://www.bioconductor.org/packages/release/bioc/html/edgeR.html). Genes were defined as differentially expressed if they exhibited a 2-fold or greater change between the air and high-CO₂ samples and a false discovery rate (FDR) of 5% or less. Differentially expressed genes were regarded as up-regulated if their expression levels in high-CO₂ samples were significantly higher than those in air samples. Conversely, genes that showed lower expression levels in the high-CO₂ samples were regarded as down-regulated. Gene set enrichment analyses were performed using goatools (https://github.com/tanghaibao/goatools) and KOBAS (http://kobas.cbi.pku.edu.cn/home.do).

Quantitative real-time PCR (qRT-PCR) validation

Cultivation of microalgae under continuous aeration with different concentrations of CO₂

All Chlorella PY-ZU1 cultivation experiments were performed in an artificial greenhouse at 27 °C. Initial biomass concentration was maintained at 0.2 g L⁻¹. Microalgae were cultivated in the cylindrical photoreactors (BR) (160 × Ф56 mm; 300-mL working volume) with the optimized SE medium (SE* medium). SE* medium contained 1 g of NaNO₃, 0.15 g of K₂HPO₄·3H₂O, 0.15 g of MgSO₄·7H₂O, 0.025 g of CaCl₂·2H₂O, 0.025 g of NaCl, 40 mL of soil extract, 0.005 g of FeCl₃·6H₂O, 1 mL of Fe-EDTA, and 1 mL of A5 solution in 958 mL of deionized water [1]. Enriched CO₂ gas [from 384 ppm to 60% (v/v)] was bubbled into the BR via a pipe at a rate of 30 mL min⁻¹. Initial pH was adjusted to 6.5 by using 0.1 M HCl and 0.1 M NaOH. During incubation, light intensity of 6000 Lux was applied on the surface of the BR with four cool white lights and two plant lights (TLD 36 W; Philips) fixed above the BR.

To obtain the dry biomass during cultivation, 10-mL samples were dewatered by centrifugation (Beckman Avanti J26-XP, USA) at 8500 rpm for 10 min and dried at 70 °C for 24 h. Biomass yield (g L⁻¹) was calculated from the microalgae dry weight produced per liter. Chlorophyll was extracted by macerating microalgae in DMSO/80% acetone (1/2, V/V) and then measured [18]. NO₃ ⁻ concentrations were analyzed by ion chromatography (MagIC, Metrohm, Switzerland). All experiments were performed in duplicate, and all data showed were reported as mean values and standard deviations (in figures) or standard errors (in tables) in this study.

Calculation of dissolved CO₂ concentration

The influent and effluent CO₂ concentrations were monitored online by a CO₂ analyzer (Servomex4100, UK). At a constant temperature of 27 °C, K _H = 3.2 × 10⁻² M atm⁻¹ and K _a1 = 4.3 × 10⁻⁷ M [19]. [H⁺] = 10^−pH, \(P_{{{\text{CO}}_{ 2} }} = {\text{mean }}\left( {P_{{{\text{CO}}_{ 2} {\text{input}}}} , \, P_{{{\text{CO}}_{ 2} {\text{output}}}} } \right).\)

Reconstruction of inorganic carbon transport pathways

The microstructure of Chlorella PY-ZU1 was also measured by TEM in our previous study [20]. An apparent protein body (pyrenoid) was found inside the chloroplast in Chlorella PY-ZU1 from the image. The microstructure of Chlorella PY-ZU1 used in this work were compared with that of the green microalgae Chlorophyta, one species with the same genus of Chlorella PY-ZU1. In the Chlorophyta a pyrenoid is localized inside the chloroplast, starch often is accumulated around the pyrenoid and the presence of concentric thylakoid systems is visible around this starch sheath [21]. CCM goes on the pyrenoid model, and CA is in the pyrenoid that localized in chloroplast [22]. CCM goes on passive diffusion of CO₂ through the plasmalemma and active bicarbonate transport into the chloroplast [8, 21]. Inorganic carbon transport pathways reconstructed based on de novo assembly and annotation of Chlorella PY-ZU1. The genes involved in these pathways in Chlorella PY-ZU1 were condensed and simplified according to their transcript abundances.

Gene expression of carbonic anhydrase and rubisco under high CO₂ stress

Chlorella PY-ZU1 had a higher biomass yield (2.85 g L⁻¹) and shorter growth cycle (7 days) when cultivated in SE medium under continuous aeration with 15% (v/v) CO₂ gas. This CO₂ concentration is equivalent to that of flue gas from most coal-fired power plants. By contrast, the biomass concentration of Chlorella PY-ZU1 was only 1.30 g L⁻¹ after 10 days of cultivation under air. It was previously reported that high CO₂ induced algae growth [23]. Carbon fixation and nitrogen metabolism are the two most important aspects of primary cell metabolism. Therefore, we expected to observe significant differences in the expression of genes encoding enzymes of carbon fixation and nitrogen metabolism.

When aerated into the microalgal suspension, CO₂ first dissolves in the medium, and then transfers from the extracellular culture medium through the cell membrane to the intracellular chloroplast. Then, CO₂ is converted by ribulose-1,5-bisphosphate (RuBP) upon the catalysis of RuBP carboxylase (rubisco) to 3-phosphoglycerate (PGA), the precursor of structural materials in microalgal cells [24]. Rubisco (rbcS, EC4.1.1.39), the first enzyme of the Calvin cycle, fixes CO₂ into the three carbon atoms of RuBP (\({\rm CO}_{2} + {\rm C}5\mathop{\longrightarrow}\limits^{{\rm Rubisco}}2{\rm C}3\)). The transcript abundance of RuBP increased slightly from 11,043.90 to 11,478.37 under high CO₂ (15% CO₂), whereas it was highly expressed under both high (15% CO₂) and low (air) CO₂ (Fig. 2). A 2-fold increase in transcript abundance was observed for PGK (EC2.7.2.3), which catalyzes the phosphorylation of 3-PGA to 1,3-bisphosphoglycerate. Moreover, triose phosphate isomerase (tpiA, EC5.3.1.1), which reversibly converts GAP into dihydroxyacetone phosphate (DHAP), increased by approximately 10.4-fold. The transcript abundance of a series of enzymes that converts GAP to sedoheptulose-7-phosphate (S7P), such as fructose-1,6-bisphosphatase aldolase (fbaB, EC4.1.2.13), increased more than 2-fold, whereas those of transketolase (tkt, EC2.2.1.1) and sedoheptulose-1,7-bisphosphatase (SBPase, EC3.1.3.37) improved slightly. Ribose-5-phosphate isomerase (rpiA, EC5.3.1.6), which converts R5P into ribulose-5-phosphate (Ru5P), increased by 7.8-fold. Phosphoribulokinase (prkB, EC2.7.1.19), which phosphorylates Ru5P into RuBP, increased by 4.0-fold. Therefore, almost all of the enzymes involved in the Calvin cycle had increased transcript abundances (Additional file 1) under high CO₂. The results indicated that the whole carbon fixation process was driven by 15% CO₂ gas. Therefore, the growth rate of Chlorella PY-ZU1 increased under 15% CO₂ compared with under air (Fig. 1).

Moreover, rubisco was still highly expressed even Chlorella PY-ZU1 was cultivated under limited CO₂, such as air. The high expression of rubisco was caused by CCM in microalgae cells. Rubisco is only activated when CO₂ concentration is greater than its K _m (CO₂), because that CO₂ is the only carbon source that rubisco can utilize. However, when aerated with air, 99% of carbon in the culture is in the form of HCO₃ ⁻ [1]. CO₂ concentration in the medium hardly meets the requirements of rubisco because of the low solubility of CO₂. Gene transcript abundance of CAs in Chlorella PY-ZU1 pyrenoids increased to 5190 from 39 under cultivation with 15% CO₂. CAs expression increased to maintain high CO₂ concentration in pyrenoids. Furthermore, CCM was simultaneously activated as most of the dissolved inorganic carbon, HCO₃ ⁻, was transferred by pump through the chloroplast membrane into the internal pyrenoid; HCO₃ was then converted by CAs to CO₂ as function (2) in the chloroplast to meet the needs of rubisco (Fig. 2) [25]. However, CCM occurred at the cost of ATP. Increased CCM expression consumed more energy for CO₂ transfer, thus decreasing the energy available for carbon fixation and other pathways of photosynthetic growth. Conversely, when cultivated under continuous aeration with 15% CO₂, CAs was barely expressed in Chlorella PY-ZU1 pyrenoids. CCM was inactive. The CO₂ that diffused directly into pyrenoids by high CO₂ osmotic pressure was sufficient for rubisco. Therefore CO₂ transfer pathway was simplified. Hence, more ATP was available for photosynthesis to promote growth.

$${\rm HCO}_{3}^{ - } + {\rm H}^{ + } \mathop{\longrightarrow}\limits^{{{\text{Carbonic anhydrase}}}}{\rm CO}_{2} +{\rm H}_{2} {\rm O}$$

(2)

CAs and rubisco are the most important genes of carbon fixation pathways. To confirm the transcriptome results, the expression levels of genes encoding CA and rubisco were measured by qRT-PCR under different cultivation times (Fig. 3a). Under high CO₂, the CAs transcript level was significantly reduced to 0 (The original data showed in Additional file 2), which is consistent with the transcriptome results (Fig. 2). Moreover, the study conducted by Fan et al. reported a similar, remarkably decreased CAs expression when oleaginous Chlorella cells were exposed to 5% CO₂ [26]. This result is also consistent with previous reports that CO₂ concentration significantly affects CAs activity in Chlorella pyrenoidosa cells, and that elevating CO₂ concentration decreases CAs activity [27].

Rubisco expression levels increased under high CO₂ (Fig. 3b). This result is consistent with the transcriptome results. Under 15% CO₂, the enhanced rubisco expression of Chlorella PY-ZU1 cells might induce more CO₂ to directly permeate intracellular pyrenoids for conversion into cellular energy storage molecules and to promote ATP conversion to glucose, thereby improving the photosynthetic efficiency of microalgae. Therefore, high CO₂ concentrations reduced the ATP consumption of CO₂ transfer. On the other hand, high CO₂ concentrations improved CO₂ conversion and photosynthetic efficiency, thus eventually reducing the growth cycle and increasing the biomass yield (2.85 g L⁻¹) of Chlorella PY-ZU1.

In addition, the time when rubisco had highest transcriptional level (24 h of high CO₂ and 48 h of air) and the time CAs had lowest transcriptional level under air (48 h) were also the time when maximum microalgae growth rate was achieved (24 h of high CO₂ and 48 h of air) (Fig. 1). That fully illustrated that CAs and rubisco had the ability to regulate microalgae growth.

Response of nitrogen metabolism and chlorophyll synthesis to high CO₂ stress

Similar to carbon fixation, the transcript abundance of important enzymes in nitrogen metabolism, including those of nitrate reductase, nitrite reductase and glutamate dehydrogenase (ghdA), also increased under high CO₂ (Fig. 4a). Nitrogen is an essential element for chlorophyll and protein synthesis. After nitrate reductase and nitrite reductase increased, nitrate ions absorbed by microalgae were immediately catalyzed to nitrite ions and then to ammonia through a series of reduction reactions to synthesize nitrogenous compounds, such as amino acids, which in turn increased the efficiency of nitrate ion uptake from the medium by microalgae cells. On the aspect of nitrogen source consumption (in this study, the nitrogen source was sodium nitrate), Chlorella PY-ZU1 consumed almost all of the 3 mM nitrate during the first 2 days, especially on the first day (Fig. 4b) when cultivated under continuous aeration with 15% CO₂. By contrast, Chlorella PY-ZU1 only consumed 1.26 mM nitrate during the first 2 days, and nitrate was not completely consumed until the sixth day when cultivated under air. On the genetic level, the transcript abundance of nitrate reductase, the first enzyme in nitrogen metabolism, increased by approximately 10-fold by the 24th h and 8-fold by the 48th h under high CO₂ compared with that under air (Fig. 4c). The higher transcript expression of nitrate reductase accelerated the transformation of nitrate to nitrite and O₂ catalyzed by nitrate reductase (Function 3). This higher gene expression might manifest by the rapid consumption of nitrate. Furthermore, by the catalysis of the up-regulated nitrite reductase, more nitrite was converted to amino acid synthesis precursors, such as ammonia (Function 4), thereby accelerating the synthesis of proteinaceous materials, such as chlorophyll (Fig. 4d).

$$2{\rm NO}_{3}^{ - } \mathop{\longrightarrow}\limits^{{\rm Nitrate}\,\, {\rm reductase}}2{\rm NO}_{2}^{ - } + {\rm O}_{2}$$

(3)

$${\rm NO}_{2}^{ - } + 6{\rm NADPH}\mathop{\longrightarrow}\limits^{{\rm Nitrite}\,\,{\rm reductase}}{\rm NH}_{4}^{ + } + 2{\rm OH}^{ - } + 6{\rm NADP}$$

(4)

Under 15% (v/v) CO₂, 23.65 mg L⁻¹ of chlorophyll was produced during the first day of cultivation. Chlorophyll concentration remained stable in the range of 23–26 mg L⁻¹. All of the 3 mM nitrate in the medium was consumed during the following 3 days (Fig. 4d). Chlorophyll was vital in photosynthesis and allowed Chlorella PY-ZU1 cells to absorb energy from light. Moreover, light conversion efficiency is linearly correlated with chlorophyll content [1, 28]. Increased chlorophyll provided more energy for photosynthetic reactions, thereby improving the photosynthetic growth rate of Chlorella PY-ZU1. However, the high nitrogen consumption during the first 3 days resulted in nitrogen deficiency in the following days under 15% CO₂. Microalgae consumed its chlorophyll to maintain cell growth under nitrogen deficiency from the 4th day, and the chlorophyll content of Chlorella PY-ZU1 decreased. By contrast, chlorophyll content of Chlorella PY-ZU1 still increased when cultivated under air. Given that chlorophyll synthesis is almost directly proportional to nitrate concentration in the culture medium, the chlorophyll contents of Chlorella PY-ZU1 were almost the same under different CO₂ conditions by the end of the cultivation period [1, 29]. However, during cultivation, the chlorophyll content of Chlorella PY-ZU1 cultivated under 15% CO₂ was always higher than that of under air, which resulted in higher microalgae growth rate (Fig. 1).

Analysis of different concentrations of CO₂ transport and fixation mechanisms

Figure 5 shows the biomass productivity of Chlorella PY-ZU1 cultivated in optimized SE medium under different CO₂ concentrations. Excessively low (<1%) and high (>30%) CO₂ concentration could restrain microalgae growth and resulted in lower biomass yield (<2 g L⁻¹). However, when cultivated under 1% CO₂, the biomass yield drastically increased by 130.2% to 3.73 g L⁻¹ compared with the 1.62 g L⁻¹ obtained by cultivation under 0.5% CO₂. The drastically increased biomass yield in response to higher CO₂ concentrations indicated some changes in the pathway of CO₂ transfer and utilization by microalgae. CCM will work when microalgae is cultivated under limited CO₂ conditions, such as air. However, it will not work if the CO₂ that directly diffused to pyrenoids by extra- and intracellular CO₂ osmotic pressure is sufficient for rubisco, more energy was concentrated for cell growth. Thus, biomass productivity was dramatically enhanced [11]. An external concentration of 0.5% CO₂ was too low for Chlorella PY-ZU1 because it could not supply enough CO₂ through osmosis to rubisco. However, 1% external CO₂ could overcome diffusion resistance to enable CO₂ flux from the external medium to the cytoplasm. Moreover, enough CO₂ diffusion by high CO₂ stress to the cytoplasm resulted in non-operational CCM. Therefore, >1% external CO₂ concentration maintained enough CO₂ in pyrenoids for rubisco only through direct diffusion, which is dependent on extra- and intra-cellular CO₂ osmotic pressure. When cultivated under 3–30% CO₂, Chlorella PY-ZU1 had stable, higher biomass yields of 4.60–4.78 g L⁻¹. Therefore, 3–15% was ideal CO₂ concentration for Chlorella PY-ZU1 growth. However, when CO₂ concentration exceeded 30%, excess CO₂ inhibited microalgal growth and sharply decreased biomass yield (1.89 g L⁻¹). Therefore, >30% external CO₂ is too high for Chlorella PY-ZU1 given the overly acidic culture after aeration with higher CO₂ concentrations [26, 27].