Skip to main content

Advertisement

Springer Nature is making Coronavirus research free. View research | View latest news | Sign up for updates

Table 1 Primers used in this study

From: Production of (2R, 3R)-2,3-butanediol using engineered Pichia pastoris: strain construction, characterization and fermentation

Primer name Sequence (5′–3′)
AlsS-f CGGGGTACCATGTTGACTAAGGCTACTAAGGAACAAA
AlsS-r TCCCCGCGGTTACAAAGCTTTAGTCTTCATCAAC
AlsD-f CGGAATTCAAAATGAAGAGAGAGTCCAACATCCAAG
AlsD-r CGGGGTACCTTATTCTGGTGATCCCTCGGTTGTT
BDH1-f CGGAATTCAAAATGAGAGCTTTGGCATATTTCAAGA
BDH1-r CGGGGTACCTTACTTCATTTCACCGTGATTGTTA
udhA-f CGGGGTACCAAAATGCCACATTCCTACGATTACGATG
udhA-r TGCTCTAGATTAAAACAGGCGGTTTAAACCGTTT
HIS4-f GAAGATCTATGACATTTCCCTTGCTACCTGC
HIS4-r CGGGATCCTTAAATAAGTCCCAGTTTCTCCATACG
  1. Restriction sites are underlined