Open Access

The JatrophaFT ortholog is a systemic signal regulating growth and flowering time

  • Jian Ye1, 2,
  • Yunfeng Geng1,
  • Bipei Zhang1,
  • Huizhu Mao1,
  • Jing Qu1 and
  • Nam-Hai Chua3Email author
Biotechnology for Biofuels20147:91

https://doi.org/10.1186/1754-6834-7-91

Received: 23 December 2013

Accepted: 15 April 2014

Published: 12 June 2014

Abstract

Background

Jatropha curcas is being promoted as a new bioenergy crop in tropical and subtropical regions due to its high amount of seed oil and its potential capacity to grow on marginal land for biofuel production. However, the productivity of the plant is constrained by the unfavorable flowering time and inflorescence architecture, which render harvesting of seeds time-consuming and labor-intensive. These flowering-related traits have limited further widespread cultivation of Jatropha.

Results

We identified a Jatropha curcas homolog of Flowering locus T (JcFT) and demonstrated its function by genetic complementation of the Arabidopsis ft mutant. The JcFT expression level was found to be remarkably correlated with leaf age. Overexpression of JcFT in Jatropha reduced flowering time and altered plant architecture by producing more branches. Grafting experiments suggested that the earlyflowering and alteration of plant architecture traits were graft-transmissible. We also showed that the FT-overexpressing transgenic Jatropha can be used as a root stock for grafting of scions derived from other Jatropha.

Conclusion

We generated early flowering transgenic Jatropha plants that accumulate higher levels of the florigen FT. Not only early flowering but also plant growth was affected in JcFT overexpression lines. More seeds can be produced in a shorter time frame by shortening the flowering time in Jatropha, suggesting the possibility to increase seed yield by manipulating the flowering time.

Keywords

Biodiesel Flowering locus T Jatropha Transgenic Grafting

Background

Biofuels have been recognized as a national priority for many countries as an alternative source to meet their energy security needs. The demand for biofuel has placed increasing pressure on food production, which further raises the 'food vs fuel' debate. For instance, to satisfy the biofuel need for Germany in 2017 as mandated by the German government, all agricultural land for food production has to also be used for rape seed derived biodiesel production [1]. To ease the competition between food and fuel for arable land while satisfying the need for renewable fuels, it is well recognized that the first choice is to use marginal or degraded land for the production of biofuel crops [2].

Jatropha curcas, a small seed-propagated woody plant belonging to the family Euphorbiaceae, is a non-food plant used for biofuel production. This plant has the potential to solve in part the competition between food and fuel mainly because of its wide adaptability, drought tolerance and its ability to thrive on degraded soils [3, 4]. At present, the key agronomic trait targeted by Jatropha breeders is the productivity of the plant [3]. Flowering is a prerequisite for crop production whenever fruits or seeds are harvested. The productivity of Jatropha is constrained by an unfavorable male-to-female flower ratio that has not been optimized by conventional breeding. Jatropha is monoecious and produces male and female flowers on the same inflorescence [5]. Not surprisingly, the productivity of the Jatropha plant is also highly affected by geographical and environmental conditions [6, 7]. Physiological and genetic analysis of flowering has shown that multiple environmental and endogenous inputs influence the timing of the transition from vegetative to reproductive growth [7, 8]. Jatropha mainly grows in tropical and subtropical regions between 30°N and 35°S [6, 9]. It can produce limited amounts of seeds at high altitudes (>500 meters above sea level), where the majority of marginal land is located in the world. However, it is unable to flower and produce seeds in areas with low light intensity and poor light quality [9]. Lastly, unsynchronized flowering and fruit setting renders harvesting of Jatropha seeds highly labor-intensive; in fact, high labor cost is the primary fixed cost in Jatropha fruit production [3, 4]. Therefore, it is essential to systematically study the Jatropha flowering biology so as to devise strategies to synchronize flowering and increase seed yield [9]. With a better understanding of molecular and genetic mechanisms of flowering, it will be possible to generate next-generation Jatropha plants by traditional breeding and/or genetic engineering.

At a certain point in their life cycle, annual plants undergo a major developmental transition in which they switch from vegetative to reproductive growth [9]. Although the draft genome sequence of Jatropha has been reported, little genetic and mechanistic research on regulation of flowering time or control of male/female flower ratio has been done [10]. The male-biased ratio within an inflorescence limits Jatropha seed production; hence, more female flowers in a plant will produce more fruits and seeds. Meanwhile, to precisely control the time of flowering, plants have evolved mechanisms to integrate seasonally predictable environmental cues (such as changes in photoperiod and prolonged periods of cold temperatures) and developmental cues (such as maturity).

In the model plant Arabidopsis thaliana, the FLOWERING LOCUS T (FT) protein serves as a flowering-inducing signal [11]. FT is a member of a protein family that contains a plant-specific phosphatidylethanolamine-binding protein (PEBP) domain. In Arabidopsis, the PEBP family is divided into three subfamilies, namely FT-like, TERMINAL FLOWER1 (TFL1)-like, and MOTHER of FT and TFL1 (MFT)-like. FT and TFL1 are thought to be molecular switches regulating vegetative and reproductive growth, whereas MFT is phylogenetically ancestral to the two proteins. In other plants, such as tomato, the balance between the activity of tomato FT homolog SINGLE FLOWER TRUSS and that of the TFL1 homolog SELF-FRUNING affects a variety of developmental processes, such as flowering response, reiterative growth, termination cycles, leaf maturation and stem growth [1214]. In the sugar beet, flowering time is controlled by the interplay between two paralogs of the Arabidopsis FT gene that have evolved antagonistic functions. BvFT2 is functionally conserved with FT and is essential for flowering. By contrast, BvFT1 functions as a flowering terminator (TFL1) to repress flowering, and its down-regulation is crucial for vernalization in beets [15]. Therefore, all three subfamilies of PEBP genes can function as general developmental regulators rather than simple floral initiators or florigens [12].

In this study, we functionally identified an FT homolog JcFT gene from Jatropha by genetic complementation of the Arabidopsis thaliana ft-10 mutant. We showed how manipulation of Jatropha flowering time can lead to yield increase. A rapid breeding technology for Jatropha using earlyflowering transgenic plants and marker-assisted selection is also discussed.

Results

Identification of FT genes from Jatrophaand other Euphorbiacious plants

By analysing the database of a sequenced cDNA library prepared from J. curcas seeds [16], several Flowering locus T-related genes and one Jatropha curcas Flowering locus T homolog (JcFT) were identified. At the amino acid level JcFT is 86% identical to Arabidopsis FT. Using the amino acid sequence of JcFT, we further identified FT-like genes from other Euphorbiacious plants such as castor bean (Ricinuscommunis) and cassava (Manihotesculenta) by mining data in Phytozome [17]. Phylogenetic analysis of PEBP domain family proteins from various plants indicated that PEBP proteins fall into three groups: the FT group, which promotes flowering; the TFL1/CEN-like group, which prolongs vegetative identity; and the MFT group, which is ancestral to the FT and TFL1 groups. As the JcFT protein and FT-like proteins in Euphorbiacious plants are located in the FT-like group, we deduced that this JcFT is an FT-like protein (Figure 1A). Using the polymerase chain reaction (PCR) approach, we cloned an FT cDNA from a Jatropha leaf sample. Southern blot analysis, using the JcFT cDNA as a probe, revealed only one copy of the FT gene in the Jatropha genome (see Additional file 1). That there is only one FT homologous gene in the Jatropha genome was further confirmed through mining of both the deep sequencing data set of Jatropha performed at the Temasek Life Sciences Laboratory (Yan Hong, unpublished data) and the Jatropha genome database available online (Sato et al., [10]). Analysis of genomic structures of FT homologous genes from Euphorbiaceae showed that they are similar to that of the Arabidopsis FT gene (Figure 1B). The second intron of the JcFT and the Ricinuscommunis FT (RcFT) is very big in size (Figure 1B), and is similar to that of the sugar beet FT (BvFT2) [15].
Figure 1

Identification of PEBP-related genes from several members of Euphorbiaceae. (A) Phylogenetic analysis of PEBP family proteins in plants. A Neighbor-Joining phylogenetic analysis of multiple members of the PEBP family from several plant species. Bootstrap values for 1,000 resamplings are shown on each branch. (B) Genomic organization of FT genes from Jatropha curcas (Jc), Arabidopsis thaliana (At), Beta vulgaris (Bv), Ricinuscommunis (Rc) and Manihotesculenta (Me). Boxes and lines represent exonic and intronic regions, respectively. Numbers refer to the length of DNA in base pairs. (C) Age-dependent expression of JcFT in Jatropha leaves. The newly formed leaf upon emergence of the first inflorescence was considered as +1. JcFT RNA levels from leaves at three different positions (+3, +5, +9) were measured and normalized with respect to ubiquitin mRNA. Values are mean ± SD (n = 3).

We investigated the relationship between JcFT transcript levels in leaves of different ages and found that the JcFT transcript level increased from younger to older leaves (Figure 1C). These data suggest that FT expression is correlated with plant age and is important for Jatropha flowering regulation.

Transgenic Arabidopsis plants expressing JcFTwith early flowering phenotype

To determine the roles of JcFT in planta, we tested the function of JcFT in the model plant Arabidopsis thaliana. First, we constructed a binary vector pCAMBIA 2 × 35S:JcFT, containing the coding sequence of JcFT under the control of a double CaMV35S promoter. After transformation of Arabidopsis mutant ft-10 with pCAMBIA 2 × 35S: JcFT, the late flowering phenotype was rescued as indicated by the number of plant leaves at bolting and the final plant size of the complemented mutant (Figure 2A, B and C); by contrast, the ft-10 mutant remained in vegetative growth (Figure 2D). We further generated JcFT-overexpression lines in WT Arabidopsis Columbia (Col-0) background. All T1 plants showed expression of JcFT transcripts (see Additional file 2). Transgenic plants overexpressing JcFT displayed significantly earlyflowering phenotypes under either long day or short day conditions (Table 1). WT (Col-0) plants started bolting on average 16 days after sowing on soil, and their first flowers bloomed 21.5 days after sowing under long day conditions. By contrast, the JcFT overexpression #15 line required only 7.5 days for bolting and 13.8 days for blooming (Table 1, Figure 2E, F and G). Under long day conditions, JcFT overexpression significantly shortened the bolting time (only 47% of WT in #15) but had no effect on the time from bolting to blooming. The effect of JcFT overexpression on reducing the bolting time was even stronger under short day conditions (only 27% of WT in #15), whereas JcFT overexpression still did not have any effect on the time from bolting to blooming (Table 1). Overexpression of JcFT in Arabidopsis not only shortened plant flowering time, but also altered plant morphology such as upward curling of leaf and increased number of inflorescence branches (Figure 2G).
Figure 2

Functional analysis of JcFT in Arabidopsis . (A) Left pot: Arabidopsis ft-10; right pot: 35S:JcFT/ft-10. (B) Flowering time for WT (Col-0) control, ft-10 and 35S:JcFT/ft-10 plants. Values are mean ± SD (n = 8). (C) Comparison of plant size of WT and transgenic complementation line of 35S:JcFT/ft-10. (D) Arabidopsis ft-10 mutant remaining in vegetative growth. (E) Arabidopsis WT (Col-0) control. (F) Transgenic line #3 expression JcFT. (G) Transgenic line #15 with JcFT strong expression of 35S:JcFT/Col-0. The primary shoot is early-terminated by strong expression of JcFT (white arrow). Red arrows indicate axillary branches. Inset in (G) shows the typical upward curling cauline leaf phenotype in transgenic lines of 35S:JcFT/Col-0. Bars: 1 cm.

Table 1

Flowering time of transgenic Arabidopsis lines overexpressing JcFT under long day (LD) or short day (SD) light conditions

LINE

Bolting

Anthesis

 

Time

Leaf

Time

Rosette leaves

Cauline leaves

 

(Days)

(Number)

(Days)

(Number)

(Numbers)

LD

Col-0

16.00 ± 2.00

8.88 ± 0.83

21.50 ± 1.60

9.63 ± 0.74

1.63 ± 0.74

35S:JcFT/Col-0

     

#3

10 ± 1.41

8.9 ± 0.74

16.8 ± 2.20

9.6 ± 1.07

2.9 ± 0.32

#9

11.1 ± 1.73

8 ± 1.41

17.3 ± 0.67

8.7 ± 1.77

2.9 ± 0.74

#15

7.5 ± 0.71

6.1 ± 0.99

13.8 ± 1.69

6.8 ± 0.79

1.7 ± 0.48

SD

Col-0

42.5 ± 8.90

23.50 ± 8.60

52.50 ± 8.47

25.00 ± 7.33

5.63 ± 0.74

35S:JcFT/Col-0

     

#3

11.8 ± 1.55

7.3 ± 0.95

23.3 ± 3.30

7.4 ± 0.84

6 ± 2.21

#9

14.5 ± 1.78

7.6 ± 1.35

25.4 ± 2.55

9.2 ± 1.40

5.1 ± 1.85

#15

11.3 ± 2.06

6.9 ± 70.74

22 ± 2.54

7.4 ± 0.70

2 ± 0.82

T4 homozygous seedlings were analyzed. The day of sowing was taken as day 0. Values are mean ± SD (n = 8).

Early flowering by over expression of JcFT in Jatropha

We further tested the functional roles of JcFT in Jatropha. Transgenic shoots overexpressing JcFT from a 35S promoter were found to flower as early as the shoot regeneration stage in tissue culture (Figure 3A and B). These shoots with early flowering trait failed to generate roots. Moreover, it was difficult to graft these shoots onto WT rootstock. These observations prompted us to replace the 35S promoter with a weaker, synthetic G10-90 promoter to express JcFT (see Additional file 3). We successfully generated 10 transgenic Jatropha lines carrying G10-90::JcFT transgene. Both Southernblot and reverse transcriptase (RT)-PCR analysis verified the presence of the transgene and JcFT overexpression in transgenic Jatropha plants (see Additional file 1 and Additional file 4). Figures 4A and 5A show that ectopic expression of JcFT strongly accelerated Jatropha flowering and fruit setting. Under normal growth conditions in a greenhouse, WT Jatropha required around 8 months to produce the first inflorescence. By contrast, only 3.5 months were needed to obtain the first inflorescence for 10 primary independent JcFT overexpression lines (Figure 5A). Seeds of two early flowering T0 lines JcFT overexpression lines (#33 and #43) were germinated on plates and the seedlings transferred into soil at the two-true-leafstage together with the WT control. The flowering times of the T1 plants of #33 and #43 were dramatically shortened to 1 to 2 months, from 8 months (Figures 4E, 5B and Additional file 5). The great reduction of time to flowering considerably shortened the time for seed set, which is one of the key determinant factors for Jatropha yield. We further found that the JcFT expression level was correlated with flowering time in Jatropha (Figure 5B). However, there was no significant role of JcFT on the time from in florescene emergence to blooming, and the time from seed set to seed maturation (data not shown).
Figure 3

Early flowering phenotype of transgenic Jatropha expressing 35S:JcFT. (A) Transgenic J. curcas shoots expressing 35S:GFP. Bar = 1 cm. (B) Transgenic J. curcas shoots expressing 35S:JcFT. *indicates inflorescences. Bar = 1 cm.

Figure 4

Functional analysis of JcFT in Jatropha. (A) Comparison of plant architecture of JcFT transgenic T1 plant (#43, right) with WT Jatropha plant. Red lines indicate the leaf position of the first and second inflorescences. Bar: 10 cm. (B): A 12-month old WT Jatropha plant. Red lines indicate the leaf position of the first and second inflorescences. Bar: 10 cm. (C) Segregated Jatropha transgenic T1 plant (#43) showing similar flowering traits as WT Jatropha plant. Bar: 10 cm. (D) Schematic diagram of plant architectures in WT and JcFT-overexpressing Jatropha plants. (E) Comparison of WT Jatropha (left) and JcFT-overexpressing transgenic T1 plant (#33, right) with early inflorescence (Inf). Bar: 1 cm. Besides early flowering, JcFT-overexpressing plants produce smaller leaves but with higher leaf number. Bar: 1 cm. (F) Typical WT Jatropha sympodial unit structure: two infloresences (Inf) and two lateral shoots (LS). (G) and (H) Enlarged view showing sympodial unit structure of JcFT-overexpressing transgenic T1 plant (#33): one inflorescence (Inf) and two lateral shoots (LS). Coty: cotyledon. White arrow: lateral shoots. Star: flower bud. L: leaf. Bar: 1 cm. (I) Increased branching in JcFT-overexpressing transgenic Jatropha. Bar: 1 cm. (J) A JcFT transgenic T1 plant (#33) with strong phenotype showing extreme early flowering. Note that the plant produces one single flower at the cotyledon stage. Bar: 1 cm. (K) Comparison of fruit size of WT Jatropha (left) and transgenic Jatropha plant overexpressing JcFT (right). Bar: 1 cm.

Figure 5

Agronomic traits of early flowering Jatropha by JcFT over expression. (A) Flowering time in T0 Jatropha plant overexpressing JcFT. Flowering time was scored by the number of days from transplantation to soil to the day of first inflorescence emergence. Values are mean ± SD (n = 10). **indicate P < 0.01. (B) Correlation of early flowering (left panel) with JcFT expression level (right panel) in T1 Jatropha plants (#33 and #43).Values are mean ± SD (n = 3).**indicate P < 0.01. (C) JcFT overexpression reduces the time for flowering dormancy. The dormancy time is indicated by the numbers of leaves formed between the first and the second inflorescence. Values are mean ± SD (n = 3). **indicate P < 0.01. (D) Comparison of branch number of WT plant and two T1 JcFT overexpression lines (#33 and #43). Values are mean ± SE (n = 5). (E) Comparison of dry seed weight of WT and two T1 JcFT overexpression lines (#33 and #43). Values are mean ± SE (n = 10). (F) Comparison of seed number of WT plant and T0 JcFT overexpression lines (n = 4). (G) Comparison of seed number of WT plant and T1 JcFT overexpression line #43. * and ** indicate P < 0.05 and P < 0.01, respectively. Values are mean ± SE (n = 5). (H) Early flowering trait induced by JcFT overexpression was insensitive to low temperature. Flowering time was scored by the number of days from seed germination to the day of first inflorescence emergence. T1 transgenic plants of line #33 were used. Values are mean ± SD (n = 3). Null segregant derived from #33 (Null #33) was used as a control.

The time for flowering dormancy, a period between the initiation of inflorescence and the next, was also drastically reduced by JcFT overexpression as indicated by the number of leaves developed between the first to the second inflorescence (Compare Figure 4A with B, and Figure 5C). Besides early flowering, JcFT-overexpressing plants produced more leaves but with smaller leaf size (Figure 4A, E and Additional file 5).

Overexpression of JcFT was found to also change the Jatropha architecture. Figure 4D and F show a typical WT Jatropha sympodial unit structure including two inflorescences and two lateral shoots. The sympodial unit structure in JcFT-overexpressing plants included only one inflorescence and two shoots (Figure 4D, G and H). Due to the short dormancy time, more branches were also found in JcFT-overexpressing Jatropha plants (Figures 4A, I and 5D). Importantly, early flowering JcFT-overexpressing Jatropha consistently produced three times more seeds without compromising seed weight (Figures 4A, K, 5E, F and G), indicating the potential agronomic value of JcFT overexpression.

In addition to genetics, environmental conditions highly affect plant growth and flowering time, especially for Jatropha, a tropical plant. Our data showed that the early flowering time trait obtained by JcFT ectopic expression was not affected by lower temperature (22°C vs 28°C as optimal temperature, Figure 5H).

Graft-transmissible action of JcFT

In general, it takes 8 months for transgenic Jatropha to develop the first inflorescence under greenhouse conditions. Therefore, a method to shorten flowering time will be beneficial for the development of genetically modified Jatropha. As a mobile, long-distance signal, it is generally believed that FT is produced in the leaf and is transported to the shoot apex, where it triggers floral morphogenesis. We asked whether Jatropha FT protein can act as a mobile and graft-transmissible signal to promote flowering. To this end, we used JcFT-overexpressing plant (#43) as a root stock and a high oleic acid line of transgenic Jatropha (X8-FAD2 RNAi #34) as scion [18]. Figure 6 shows that FT overexpression in the root stock was capable of promoting flowering in the recipient scion. A parallel control experiment showed that a WT Jatropha root stock had no effect on flowering time of the grafted scion. The use of transgenic JcFT-overexpressing rootstock enabled us to save 4 months in seed production of the T0 generation of transgenic Jatropha. More interestingly, the role of JcFT on sympodial unit structure was also found to be graft-transmissible (Figure 6F).
Figure 6

Graft - transmissible action of JcFT to reduce flowering time of other genetically modified Jatropha plants. (A) Comparison of flowering time of high oleic acid (X8-34) transgenic Jatropha shoot grafted to root stock of WT or JcFT-overexpressing plants. Flowering time refers to the number of days from the day of grafting to the day of emergence of the first inflorescence. (B) Flowering time of high oleic acid (X8-34) transgenic Jatropha not affected by grafting on WT Jatropha root stock. White arrow indicates the grafting site. (C) Flowering time of high oleic acid (X8-34) transgenic Jatropha was reduced by grafting onto JcFT transgenic T1 plant (#43) root stock. White arrow indicates the grafting site. (D) Comparison between plants grafted to WT control root stock and JcFT #43 root stock. (D), WT control root stock. (E) and (F), JcFT # 43 root stock. (F) Enlarged view of sympodial unit structure. LS: lateral shoots. Red arrow indicates the first inflorescence. Bar: 10 cm.

Discussion

Regulation of flowering time of biodiesel plants has the potential to increase yield. Using Miscanthussacchariflorus, Jensen et al. (2013) found that delayed flowering results in a greater than 50% increase in biomass [19]. Here, we demonstrate that direct manipulation of the florigen FT could yield a larger number of seeds. The great reduction of time to flowering considerably shortened the time for seed set, which is one of the key determinant factors for Jatropha yield. Overexpression of JcFT was found to also change the Jatropha architecture to semidwarf stature (Figure 4D), which is ideal for mechanical harvesting of seeds to reduce labor costs. Not only flowering time, but also the inflorescence structure was affected by overexpression of JcFT in plants with distinct growth habits, monopodial Arabidopsis and sympodial Jatropha (shown in Figures 2 and 4). Overexpression of JcFT resulted in one instead of two inflorescences in one sympodial unit in transgenic Jatropha. No branching inflorescence phenotype was found in the loss-of-function Arabidopsis TFL1 mutant. TFL1 and FT have highly conserved amino acid sequences but opposing functions. Previous studies in Arabidopsis have suggested that an antagonistic interaction between the TFL1 and floral meristem identity genes, such as LEAFY (LFY) and APETALA1 (AP1), regulates the inflorescence branching pattern [9]. There are two TFL1-like proteins in the Jatropha genome [10, 20]. The roles of Jatropha TFL1 orthologs in the determination of flowering traits are being investigated by our group [20]. Nevertheless, the observed impact on plant architecture, that of increasing the number of branches in Jatropha by manipulation of the florigen FT, is likely an indirect consequence of the early and rapid initiation of flowering, rather than a direct effect on branch initiation, since each flowering event in Jatropha is accompanied by a subsequent branching event, each of which terminates in a second flowering event and subsequent branching.

Other than flowering, FT-like proteins in plants have also been recognized as major regulatory factors in a number of developmental processes including stomatal control and tuberization. These multifunctional roles of FT-like proteins are derived from extensive gene duplication that occurred during evolution. As the gene evolutionary process occurred independently in nearly all modern angiosperm lineages, it is essential to determine the spatiotemporal pattern of ectopic FT expression to minimize its negative effect on normal vegetative growth in plants [21]. An alternative way is to induce expression of FT-like proteins by using, for example, an ethanol-inducible promoter [21, 22]. Controllable flowering allows the synchronization of fruit set and collection, thus reducing labor cost, although more research is needed on the feasibility of chemical induction on an industrial scale.

Precise control of flowering time is a critical developmental process that determines the reproductive success of flowering plants. Our data demonstrated that JcFT is a mobile signal to control flowering time and a major flowering integrator in Jatropha. The earlyflowering lines reported here provide valuable germplasm, especially for marginal land and mountainous regions with conditions of poor light and high altitude (>500 meters above sea level), for example, the Sichuan, Yunnan and Guizhou provinces in China, to produce seeds in a cost-effective way. These lines can also be used to shorten the development time for other GM traits by grafting as shown in Figure 6. Transgenic seeds obtained from grafting can be used to integrate with traditional breeding processes to accelerate advancement of transgenic traits.

In comparison to herbaceous plants, the breeding of trees is more time-consuming owing to their long generation time. Shortened juvenility and precocious flowering are therefore important breeding goals. Flower initiation has been intensively studied in Arabidopsis, and orthologs/homologs of genes for LFY, AP1, and TFL1 have been cloned from apple trees among others [2325]. There are a few successful reports on a rapid breeding program in apple by genetic modification of the flowering pathway [2628]. A similar strategy can be used in breeding programs of Jatropha. Viral-based systems such as virus- induced gene silencing (VIGS) or transient expression of flowering time genes can also be good alternatives to shorten flowering time to accelerate the breeding process [2931].

Conclusions

We generated early flowering transgenic Jatropha plants that accumulate higher levels of the florigen FT. Not only early flowering but also plant growth was affected in JcFT- overexpressing lines. More seeds can be produced in a shorter time frame by reducing flowering time in Jatropha, suggesting the possibility to increase seed yield by flowering time manipulation.

Methods

Plant materials and growth condition

Seeds were obtained from Jatropha curcas (Jc-MD) elite plants preselected by Drs. Yan Hong and Chengxin Yi [32]. All control or transgenic plants were grown in a biosafety level 2 greenhouse [18]. Plant management, such fertilization, pesticide spraying, watering and artificial fertilization, was carried out according to normal practice.

JcFTcDNA isolation and plasmid construction

The Jatropha curcas Flowering locus T (JcFT) gene was first identified from the database of a sequenced cDNA library prepared from Jatropha seeds [16]. A full-length cDNA fragment was PCR-amplified with forward primer 5'-ATAAGTCGACATGAGGGATCAATTTAGAGA-3' and reverse primer 5'-TTATTTCTAGATCACCGTCTCCGTCCTCCGGT-3'. The PCR fragment was inserted in the sense orientation into the Sal I/XabI sites of the pCABMIA1300-3HA vector.

To generate β-estradiol-inducible JcFT overexpression lines, we used a cDNA fragment encoding JcFT protein. This fragment was PCR-amplified with forward primer 5'-ATAACTCGAGATGAGGGATCAATTTAGAGA-3' and reverse primer 5'-TTATTACTAGTTCACCGTCTCCGTCCTCCGGT-3'. The PCR fragment was inserted in the sense orientation into the XhoI/SpeI sites of the pX7-GFP vector as described previously by Qu et al. [18]. The construct was named pX7-JcFT.

Jatrophatransformation

We used the transformation protocol described by Qu et al. [18].

Nuclear acid extraction and analysis

DNA and RNA were isolated and analyzed according to previously described methods [18]. For quantitative PCR analysis, two primers were used for the JcFT gene (F: GTTACTTATAATCACAGAGAGGT, R: TCTCATAGCACACTATCTCTTGC). The Jatropha UBQ transcript served as an internal control for RNA samples with primers (F: GAGGTGGAAAGCTCAGATACAATT, R: AAAGTGATGGTCTTTCCGGTCAATG). For Southern blot analysis, nylon Hybond-N+ membranes were hybridized with DNA probes encoding the HPT or JcFT open reading frame [18].

Phylogenetic analysis

Multiple alignments were generated using Clustal W. The Neighbor-Joining method in MEGA4 was used to reconstruct a phylogeny tree. Bootstrap analysis was performed to estimate nodal support on the basis of 1,000 resamplings. The phylogenetic tree was constructed with proteins including sugar beet (Beta vulgarisBvFT1, No. HM448910; BvFT2, No.HM448912; BvBFT1, No.HM448916; BvCEN1, No. HM448914; and BvMFT1, No. HM448918), apple (Malus x domesticaMdFT1, No.AB161112; MdFT2, No.AB458504; MdCENa, No.AB366641; MdCENb, No.AB366642; MdTFL1, No.AB052994; BFTL1, No.EB138045; and MFTL1, No. EB134193), black cottonwood (PopulustrichocarpaPtFT1, No.XM_002311228; PtFT2, No.XM_002316137; PtCENL1, No.XM_002328224; PtCENL2, No. XM_002312775; and PtMFT, No. XM_002321471), morning glory (Ipomoea nilPnFT1, No. EU178859; and PnFT2, No. EU178860), orange (Citrus sinensisCiFT, No. CK939149; and CsTFL, No. AY344244), rice (Oryza sativaHd3a, No. NM_001063395; RFT1, No.NM_001063394; RCN1, Os11g05470), snapdragon (Antirrhinum majusCEN, No.AJ251994), arabidopsis (Arabidopsis thalianaFT, No.NM_105222; TFL1, No.NM_120465; MFT, No.NM_101672; ATC, No.NM_128315; TSF, No. NM_118156; and BFT, No. NM_125597), and tomato (SolanumlycopersicumSP, No.U84140; SP3D, No.AY186735; SP2G, No. AY186734; and SP9D, No. AY186738). The amino acid sequences encoded by JcFT (Jatropha curcas FT), RcFT (Ricinuscommunis FT) and Me FT (Manihotesculenta) are listed in Additional file 6 and [20].

Abbreviations

AP1

APETALA1

BFT

Brother of FT

FT

Flowering locus T

LFY

LEAFY

MFT

Mother of FT

TFL1

TERMINAL FLOWER1

GM: 

genetic modification

bp: 

base pairs

Jc-MD: 

Jatropha curcas MD isolate

RT: 

reverse transcriptase

VIGS: 

virus-induced gene silencing.

Declarations

Acknowledgments

We would like to thank Drs. Yan Hong, Chengxin Yi (JOil) and Yuehui He for the J. curcas Jc-MD and Arabidopsis ft-10 seeds, and Mr. Khar Meng Ng for his help in taking care of the plants. This work was supported by the Temasek Life Sciences Laboratory, J Oil and the Singapore Millennium Foundation.

Authors’ Affiliations

(1)
Temasek Life Sciences Laboratory, National University of Singapore
(2)
State Key Laboratory of Plant Genomics, Institute of Microbiology, Chinese Academy of Sciences
(3)
Laboratory of Plant Molecular Biology, Rockefeller University

References

  1. German Biomass Research Centre: Approaches for optimising the greenhouse gas balance of biodiesel produced from rapeseed. 2010, Leipzig, GermanyGoogle Scholar
  2. Carroll A, Somerville C: Cellulosic biofuels. Annu Rev Plant Biol. 2008, 60: 165-182.View ArticleGoogle Scholar
  3. Fairless D: Biofuel: the little shrub that could–maybe. Nature. 2007, 449 (7163): 652-655. 10.1038/449652a.View ArticleGoogle Scholar
  4. Ye J, Hong Y, Qu J, Wang C: Improvement of Jatropha Oil by Genetic Transformation, Volume 2. 2012, New York: Springer Science PublishersGoogle Scholar
  5. King AJ, He W, Cuevas JA, Freudenberger M, Ramiaramanana D, Graham IA: Potential of Jatropha curcasas a source of renewable oil and animal feed. J Exp Bot. 2009, 60 (10): 2897-2905. 10.1093/jxb/erp025.View ArticleGoogle Scholar
  6. Joachim H: Physic nut. Jatropha curcas L. 1996, Gatersleben, Rome: Institute of Plant Genetics and Crop Plant Research/International Plant Genetic Resources InstituteGoogle Scholar
  7. Maes WH, Trabucco A, Achten WMJ, Muys B: Climatic growing conditions of Jatropha curcas L. Biomass Bioenerg. 2009, 33: 1481-1485. 10.1016/j.biombioe.2009.06.001.View ArticleGoogle Scholar
  8. Wu JLY, Tang L, Zhang F, Chen F: A study on structural features in early flower development of Jatropha curcas L. and the classification of its inflorescences. Afr J Agric Res. 2011, 6 (2): 275-284.Google Scholar
  9. Teo ZW, Song S, Wang YQ, Liu J, Yu H: New insights into the regulation of inflorescence architecture. Trends Plant Sci. 2014, 19 (3): 158-165. 10.1016/j.tplants.2013.11.001.View ArticleGoogle Scholar
  10. Sato S, Hirakawa H, Isobe S, Fukai E, Watanabe A, Kato M, Kawashima K, Minami C, Muraki A, Nakazaki N, Takahashi C, Nakayama S, Kishida Y, Kohara M, Yamada M, Tsuruoka H, Sasamoto S, Tabata S, Aizu T, Toyoda A, Shin-i T, Minakuchi Y, Kohara Y, Fujiyama A, Tsuchimoto S, Kajiyama S, Makigano E, Ohmido N, Shibagaki N, Cartagena JA, et al: Sequence analysis of the genome of an oil-bearing tree, Jatropha curcas L. DNA Res. 2011, 18 (1): 65-76. 10.1093/dnares/dsq030.View ArticleGoogle Scholar
  11. Liu L, Zhu Y, Shen L, Yu H: Emerging insights into florigen transport. Curr Opin Plant Biol. 2013, 16 (5): 607-613. 10.1016/j.pbi.2013.06.001.View ArticleGoogle Scholar
  12. Karlgren A, Gyllenstrand N, Kallman T, Sundstrom JF, Moore D, Lascoux M, Lagercrantz U: Evolution of the PEBP gene family in plants: functional diversification in seed plant evolution. Plant Physiol. 2011, 156 (4): 1967-1977. 10.1104/pp.111.176206.View ArticleGoogle Scholar
  13. Lifschitz E, Eviatar T, Rozman A, Shalit A, Goldshmidt A, Amsellem Z, Alvarez JP, Eshed Y: The tomato FT ortholog triggers systemic signals that regulate growth and flowering and substitute for diverse environmental stimuli. Proc Natl Acad Sci U S A. 2006, 103 (16): 6398-6403. 10.1073/pnas.0601620103.View ArticleGoogle Scholar
  14. Carmel-Goren L, Liu YS, Lifschitz E, Zamir D: The SELF-PRUNING gene family in tomato. Plant Mol Biol. 2003, 52 (6): 1215-1222.View ArticleGoogle Scholar
  15. Pin PA, Benlloch R, Bonnet D, Wremerth-Weich E, Kraft T, Gielen JJ, Nilsson O: An antagonistic pair of FT homologs mediates the control of flowering time in sugar beet. Science. 2010, 330 (6009): 1397-1400. 10.1126/science.1197004.View ArticleGoogle Scholar
  16. Gu K, Yi C, Tian D, Singh JS, Hong Y, Yin Z: Expression of fatty acid and lipid biosynthetic genes in developing endosperm of Jatropha curcas. Biotechnol Biofuels. 2012, 1: 47-View ArticleGoogle Scholar
  17. Goodstein DM, Shu S, Howson R, Neupane R, Hayes RD, Fazo J, Mitros T, Dirks W, Hellsten U, Putnam N, Rokhsar D: Phytozome: a comparative platform for green plant genomics. Nucleic Acids Res. 2012, 40 (Database issue): D1178-D1186.View ArticleGoogle Scholar
  18. Qu J, Mao HZ, Chen W, Gao SQ, Bai YN, Sun YW, Geng YF, Ye J: Development of marker-free transgenic Jatropha plants with increased levels of seed oleic acid. Biotechnol Biofuels. 2012, 5 (1): 10-10.1186/1754-6834-5-10.View ArticleGoogle Scholar
  19. Jensen E, Robson P, Norris J, Cookson A, Farrar K, Donnison I, Clifton-Brown J: Flowering induction in the bioenergy grass Miscanthussacchariflorus is a quantitative short-day response, whilst delayed flowering under long days increases biomass accumulation. J Exp Bot. 2013, 64 (2): 541-552. 10.1093/jxb/ers346.View ArticleGoogle Scholar
  20. Chua NH, Ye J, Geng YF, Zhang BP: Flowering Modification in Jatropha and Other Plants, Volume WO 2013130016 A1. 2013Google Scholar
  21. Zhang H, Harry DE, Ma C, Yuceer C, Hsu CY, Vikram V, Shevchenko O, Etherington E, Strauss SH: Precocious flowering in trees: the FLOWERING LOCUS T gene as a research and breeding tool in Populus. J Exp Bot. 2010, 61 (10): 2549-2560. 10.1093/jxb/erq092.View ArticleGoogle Scholar
  22. Yeoh CC, Balcerowicz M, Laurie R, Macknight R, Putterill J: Developing a method for customized induction of flowering. BMC Biotechnol. 2011, 11: 36-10.1186/1472-6750-11-36.View ArticleGoogle Scholar
  23. Kotoda N, Hayashi H, Suzuki M, Igarashi M, Hatsuyama Y, Kidou S, Igasaki T, Nishiguchi M, Yano K, Shimizu T, Takahashi S, Iwanami H, Moriya S, Abe K: Molecular characterization of FLOWERING LOCUS T-like genes of apple (Malus x domesticaBorkh.). Plant Cell Physiol. 2010, 51 (4): 561-575. 10.1093/pcp/pcq021.View ArticleGoogle Scholar
  24. Flachowsky H, Hattasch C, Hofer M, Peil A, Hanke MV: Overexpression of LEAFY in apple leads to a columnar phenotype with shorter internodes. Planta. 2010, 231 (2): 251-263. 10.1007/s00425-009-1041-0.View ArticleGoogle Scholar
  25. Mimida N, Kotoda N, Ueda T, Igarashi M, Hatsuyama Y, Iwanami H, Moriya S, Abe K: Four TFL1/CEN-like genes on distinct linkage groups show different expression patterns to regulate vegetative and reproductive development in apple (Malus x domesticaBorkh.). Plant Cell Physiol. 2009, 50 (2): 394-412.View ArticleGoogle Scholar
  26. Flachowsky H, Szankowski I, Waidmann S, Peil A, Trankner C, Hanke MV: The MdTFL1 gene of apple (Malus x domesticaBorkh.) reduces vegetative growth and generation time. Tree Physiol. 2012, 32 (10): 1288-1301. 10.1093/treephys/tps080.View ArticleGoogle Scholar
  27. Flachowsky H, Le Roux PM, Peil A, Patocchi A, Richter K, Hanke MV: Application of a high-speed breeding technology to apple (Malus x domestica) based on transgenic early flowering plants and marker-assisted selection. New Phytol. 2011, 192 (2): 364-377. 10.1111/j.1469-8137.2011.03813.x.View ArticleGoogle Scholar
  28. Trankner C, Lehmann S, Hoenicka H, Hanke MV, Fladung M, Lenhardt D, Dunemann F, Gau A, Schlangen K, Malnoy M, Flachowsky H: Over-expression of an FT-homologous gene of apple induces early flowering in annual and perennial plants. Planta. 2010, 232 (6): 1309-1324. 10.1007/s00425-010-1254-2.View ArticleGoogle Scholar
  29. Ye J, Qu J, Bui HT, Chua NH: Rapid analysis of Jatropha curcas gene functions by virus-induced gene silencing. Plant Biotechnol J. 2009, 7 (9): 964-976. 10.1111/j.1467-7652.2009.00457.x.View ArticleGoogle Scholar
  30. Yamagishi N, Sasaki S, Yamagata K, Komori S, Nagase M, Wada M, Yamamoto T, Yoshikawa N: Promotion of flowering and reduction of a generation time in apple seedlings by ectopical expression of the Arabidopsis thaliana FT gene using the Apple latent spherical virus vector. Plant Mol Biol. 2011, 75 (1–2): 193-204.View ArticleGoogle Scholar
  31. Yamagishi N, Kishigami R, Yoshikawa N: Reduced generation time of apple seedlings to within a year by means of a plant virus vector: a new plant-breeding technique with no transmission of genetic modification to the next generation. Plant Biotechnol J. 2014, 12 (1): 60-68. 10.1111/pbi.12116.View ArticleGoogle Scholar
  32. Yi C, Zhang S, Liu X, Bui HT, Hong Y: Does epigenetic polymorphism contribute to phenotypic variances in Jatropha curcas L.?. BMC Plant Biol. 2010, 10 (259):Google Scholar

Copyright

© Ye et al.; licensee BioMed Central Ltd. 2014

This article is published under license to BioMed Central Ltd. This is an Open Access article distributed under the terms of the Creative Commons Attribution License (http://creativecommons.org/licenses/by/2.0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly credited. The Creative Commons Public Domain Dedication waiver (http://creativecommons.org/publicdomain/zero/1.0/) applies to the data made available in this article, unless otherwise stated.

Advertisement